| Home | E-Submission | Sitemap | Editorial Office |  
top_img
Korean J. Pl. Taxon > Volume 50(3); 2020 > Article
CHOI, LEE, CHO, HAN, and CHOI: Development of microsatellite markers for Hosta capitata (Asparagaceae) and amplification in related taxa

Abstract

Microsatellite markers were developed as a tool for phylogeographic studies of Hosta capitata. We also assessed cross-amplification in species closely related to Hosta capitata. We produced 28 polymorphic microsatellite markers by mapping 300 bp paired-end reads obtained from Illumina MiSeq data of H. capitata. In H. capitata, the number of alleles per locus ranged from 1 to 13. Observed and expected heterozygosity ranged from 0.000 to 0.844 and 0.000 to 0.832, respectively. Additionally, 13 loci were successfully transferable to the related species of H. minor and H. venusta. These markers will provide a powerful genetic tool not only for elucidating the phylogeographic patterns of H. capitata populations but also for studying the genetic delimitation of H. capitata from its related species.

The temperate climate zones in East Asia are one of the biodiversity hotspots with increased endemism and plant species richness in East Asian temperate forests (Qian and Ricklefs, 2000). Many phylogeographic surveys covering countries in Asia, such as China, Korea, and Japan, have demonstrated that the high plant diversity is largely derived from dynamic changes in land configurations during the Quaternary climate oscillations (e.g., Qiu et al., 2011; Lee et al., 2013). The processes and mechanisms underlying lineage diversification are major topics in evolutionary biology, and phylogeographic analysis is an essential tool to understand the speed and spatial scale of an organism’s diversification (Crisp et al., 2011; Donoghue and Edwards, 2014). In addition, differences in behaviors, such as life cycles, seed dispersal modes, and pollinators, can explain complex patterns of speciation. Thus, understanding the phylogeographic history of a given species concerning ecological factors is critical for resolving systematic controversies (Sakaguchi et al., 2018).
The genus Hosta Tratt. is widely used in gardening owing to its ground cover, shiny leaf surfaces, leaf pattern, and brilliant purple to white flowers (Jones, 1989; Chung, 1990). With ca. 45 species, Hosta is naturally distributed in Korea, Japan, China, and some parts of Russia, mainly on the edge of the forest or on grasslands in alpine regions (Chen and David, 2000; Chung, 2018). This genus was traditionally under Liliaceae (Maekawa, 1940; Fujita, 1975; Chung, 1990; Chung et al., 1991; Schmid, 1991), but more recently it has been placed in Asparagaceae (The Angiosperm Phylogeny Group et al., 2016; Jo and Kim, 2017; Lee et al., 2018). In general, the infrageneric classification of Hosta includes 3 subgenera and 10 sections (Schimid, 1991).
Hosta capitata (Kodiz.) Nakai [sect. Lamellatae F. Maek., subg. Bryocles (Salisb.) F. Maek.] shows the disjunct distribution by occurring in the main mountain range (Baekdudaegan) of Korea and western parts of Japan (Fujita, 1975; Chung et al., 1991). This species is distinguished in sect. Lamellatae by its capitate raceme (Lee et al., 2018). However, this species still has a systematic ambiguous relationship especially with its closely related H. minor (Baker) Nakai, H. venusta F. Maek., and H. nakaiana F. Maek. within the section. In particular, H. nakaiana has been treated as a synonym of H. cpitata (Tamura and Fujita, 2016; Jo and Kim, 2017), but its phylogenetic identity is still controversial (Schimid, 1991; Sauve et al., 2005). In addition, despite population genetic analyses based on allozyme (Park and Chung, 1997) and isozyme (Chung, 1994) data for H. capitata, its phylogeography and evolutionary history have not been clearly addressed so far (Schmid, 1991). Accordingly, we isolated and characterized a set of polymorphic microsatellite markers from H. capitata to provide a basis for analyses of evolutionary patterns driven by historical factors in East Asia. We also tested cross-amplification in its related species, H. minor and H. venusta of sect. Lamellatae.

Materials and Methods

To acquire an NGS library for H. capitata, we used the DNeasy Plant Kit (Qiagen, Seoul, Korea) to extract genomic DNA from a fresh leaf of a single plant sample collected from Baegunsan Mt., Gwangyang-si, Jeollanam-do, Korea (Table 1). We evaluated the quality of the DNA using a NanoDrop ND-1000 (NanoDrop Technologies, Wilmington, DE, USA). The DNA passed the quality check (concentration 317.95 ng/μL; A260/280 = 1.83; A260/230 = 2.37) was sequenced on the Illumina MiSeq platform (LAS Inc., Seoul, Korea). To identify microsatellites, sequence reads were screened using SSR-pipeline version 0.951 (Miller et al., 2013). The parameter settings for the detection of di-, tri-, or tetranucleotide motifs were flanking regions larger than 100 bp and a minimum of 10, 6, and 4 repeats, respectively. In addition, AT and TA repeats, G + C contents under 30%, and G + C contents above 80%, as well as reads with additional repeat were removed. The resulting sequences were grouped by the repeat motives and mapped to the reference using Geneious R 10.1.3. For each assembled contig, sites with identities < 80% and qualities < 50% were removed. We selected fragments with unique patterns that had less than 20 reads, two separate alleles, little variation at the site to which the primer was attached, and no additional single nucleotide polymorphisms in the flanking region. The final selected reads were deduplicated through de novo assembly and used to develop microsatellite markers. Primer pairs were designed using Primer 3 (Rozen and Skaletsky, 2000), and three sets of M13 tag sequences were added (5′-CACGACGTTGTAAAACGAC-3′, 5′-TGTGGAAT TGTGAGCGG-3′, and 5′-CTATAGGGCACGCGTGGT-3′) to the forward primer with 6FAM, VIC, and NED fluorescent dyes, respectively. For multiplex PCR (nine primer sets), each marker was 100–300 bp. To select microsatellite markers with infraspecific polymorphism for H. capitata, 90 microsatellite markers were verified using 32 individuals collected from Baegunsan Mt. The PCR protocol consisted of initial denaturation at 95°C for 10 min, followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 1 min 30 s, and extension for 1 min at 72°C, and a final extension at 4°C for 10 min. The PCR products were analyzed using an ABI 3730XL sequencer with the GeneScan 500LIZ Size Standard (Thermo Fisher Scientific, Waltham, MAs, USA). Allele sizes and peaks for each sample were determined using Peak Scanner version 2.0 (Thermo Fisher Scientific). The number of alleles and the values for HE (expected heterozygosity) and HO (observed heterozygosity) were analyzed using GeneAlEx 6.5 (Peakall and Smouse, 2005). Deviations from Hardy–Weinberg equilibrium (HWE) and linkage disequilibrium were estimated using GENEPOP 4.0 (Rousset, 2008). In addition, Micro-checker version 2.2.3 (Van Oosterhout et al., 2004) was used to determine the null allele frequencies and scoring errors.

Results and Discussion

Using the 90 newly designed primer pairs, we developed 28 polymorphic microsatellite loci from H. capitata (Table 2). The number of alleles per locus ranged from 1 to 13 (average, 4.7). HE and HO values ranged from 0.000 to 0.832 and from 0.000 to 0.844, respectively. After Bonferroni correction, three markers (Hca069, Hca70, and Hca72) showed a significant deviation from HWE (p < 0.0018), but the deviation was not consistent across the three populations of H. capitata (Table 3). We tested the 28 loci for cross-amplification in its two closely related species of H. minor and H. venusta (Table 4). From the results, 13 loci were successfully amplified and were polymorphic in both H. minor and H. venusta, with 2–10 alleles per locus. The newly developed microsatellite markers will provide a powerful genetic tool for elucidating the phylogeographic patterns of Hosta capitata populations in Korea and Japan. Furthermore, these results will be beneficial for studying the genetic delimitation of H. capitata and its related species in sect. Lamellatae.

Acknowledgments

This work was supported by grants from the National Institute of Biological Resources, funded by the Ministry of Environment of the Republic of Korea (NIBR202007103).

NOTES

Conflict of Interest
The authors declare that there is no conflict of interest.

Table 1.
Locality and voucher information for the Hosta species examined in this study.
Taxon Locality No. of individuals sampled Voucher No.
H. capitata Gwangyang, Jeollanam-do (Baegunsan Mt.) 32 CAP-15080601
H. capitata Taebaek, Gangwon-do (Deadeoksan Mt.) 24 CAP-16072901
H. capitata Bonghwa, Gyeongsangbuk-do (Okdollbong) 24 CAP-16052801
H. minor Gunwi, Gyeongsangbuk-do (Hwasan Mt.) 24 MIN-15062801
H. venusta Seogwipo, Jeju-do (Mulyeongarioreum) 24 VEN-15072801

Voucher specimens were deposited in the plant taxonomy laboratory of Changwon National University.

Table 2.
Characterization of the 28 microsatellite loci developed from Hosta capitata.
Locus Primer sequence (5′–3′) Repeat motif Size range (bp) GenBank accession No.
Hca004 F: GGAACTGGGCTAAGTGTAAA (TC)10 124–138 MT084644
R: TACTGACACGCACAAAATTC
Hca005 F: GCTGGATCAACTGTAATGGA (GA)11 162–186 MT084620
R: CAAAGCCAGGTTAGTGTACT
Hca007 F: ATGATATGCAGTTGGGATGT (GT)10 129–133 MT084645
R: ACACACTTACATGCACACA
Hca010 F: CGAGCATCACACTAAATCAC (TC)10 125–161 MT084621
R: AGGAGCATAATAGAACCCCT
Hca012 F: CCTGCTGAGATACACACAAT (GA)12 224–244 MT084622
R: TGAGAGTTCTAGGGATTGGT
Hca014 F: CATTAAGAGAGGGTTGGCAT (GAT)6 180–198 MT084623
R: GGGCACTGAAGAACATAGAA
Hca017 F: TACTGAGATCCCTTGTTCGT (CT)13 188–208 MT084624
R: GTCAGCTCACAGGAATAGAG
Hca031 F: TGTAATCCTCTCCATCTCCA (TC)14 133–149 MT084625
R: CAATGCACAAATCAGAGACA
Hca033 F: ATCTCGGCGTAAATCTGATC (AGA)12 232–256 MT084626
R: ATGCTTTACCTCACCATCTG
Hca037 F: AGCTAACATTTGACTTTTGCT (GTG)7 151–160 MT084646
R: AGATTCCTGGCAAATTTCCA
Hca038 F: AGACTGGAGAACTGCCTAA (CT)13 192–206 MT084627
R: GATGCGAGGGTCATTCTATT
Hca040 F: TGTTCTTTGCTTGCTTCTTC (AG)11 160–168 MT084628
R: GGTATTTCCTTTGAGAGAAACT
Hca041 F: AGACCAAATAAAAGCCTGCA (AG)17 198–220 MT084629
R: CAGAGTTGGTTTTAAAGCGT
Hca045 F: ACTCCATTGTAACCTTCTCTC (TG)20 262–284 MT084630
R: AGAGGTTTGGATATGGGAGA
Hca048 F: CTGCAACACATGGCAAAATA (AG)17 248–278 MT084631
R: ATCACTCCATAGCTGATCCA
Hca050 F: AAATCTTTCAGCCGATGGAT (TC)15 203–219 MT084632
R: AGTAATTATCAACACGGCAA
Hca051 F: TGTTAAAGGGGATTAAGTGAGA (GA)21 244–272 MT084633
R: GGTCTCCTCCAACAAGATTT
Hca055 F: AGAGTAAGAGACACACGGAA (GA)11 132–142 MT084634
R: GGTTTGGGCCATCTCTATC
Hca057 F: TCTAAAGATAAAATGGGCCTCT (AG)17 203–236 MT084635
R: TTTTCTGCATTTACCTAACACC
Hca062 F: TCGATACGGCTTAGACAAAG (CT)12 203–217 MT084636
R: GGAAAATTGTGGTCTTCGTC
Hca065 F: TGGAAGCAAGTGGTGAAATA (GT)17 190–218 MT084637
R: ACTTGTGTTGCCTATTCAAAC
Hca066 F: AAACCGGCATGACCAATTTT (GT)11 253–260 MT084647
R: TGGGTCTAGTTACTCATTCCA
Hca069 F: TGTTGTAGATACAGAGCACG (GA)13 214–246 MT084638
R: TAGATGCATGAGAAGGAAGC
Hca070 F: CAGAACTCATCACTGGACTC (CT)11 122–138 MT084639
R: GGAACTCTGCTCTTCAATCA
Hca071 F: AAGGAGTACAAACAGCAACA (AGA)8 163–181 MT084640
R: GTCCTACAGAACTCGTCCT
Hca072 F: CTCAAACCAGCTGATGCATA (GA)11 200–224 MT084641
R: TTTGAAGCTTCTTGACCCAT
Hca085 F: GCGCCCTCAGTTATATTCAA (AC)14 126–140 MT084642
R: GGAGATCAGAGGAGTCAGTA
Hca086 F: CTGATTTTAACGTCCATGGAC (AC)10 196–202 MT084643
R: TTTGGCATTTTGGAGATCCT
Table 3.
Genetic properties of 28 microsatellite loci in separate populations of Hosta capitata.
Locus H. capitata

Baegunsan Mt. (n = 32) Daedeoksan Mt. (n = 24) Okdollbong (n = 24)



A HE HO A HE HOa A HE HOa
Hca004 5 0.286 0.258 1 0.000 0.000 1 0.000 0.000
Hca005 8 0.743 0.645 3 0.569 0.583 3 0.436 0.261*
Hca007 3 0.606 0.594 1 0.000 0.000 2 0.478 0.292
Hca010 9 0.439 0.438 6 0.734 0.750 5 0.688 0.583
Hca012 7 0.644 0.531 7 0.737 0.667 3 0.390 0.304
Hca014 2 0.390 0.406 3 0.378 0.375 3 0.484 0.375
Hca017 7 0.823 0.781 4 0.442 0.458 2 0.041 0.042
Hca031 7 0.710 0.688 3 0.508 0.375 4 0.194 0.167
Hca033 8 0.799 0.806 3 0.536 0.458 3 0.546 0.500
Hca037 2 0.324 0.406 1 0.000 0.000 1 0.000 0.000
Hca038 4 0.630 0.690 3 0.508 0.542 3 0.155 0.167
Hca040 6 0.686 0.719 3 0.588 0.583 3 0.503 0.250**
Hca041 11 0.817 0.719 4 0.416 0.417 2 0.469 0.333
Hca045 8 0.827 0.781 5 0.358 0.250 4 0.120 0.125
Hca048 13 0.807 0.781 3 0.555 0.542 5 0.326 0.357
Hca050 6 0.758 0.750 4 0.610 0.583 7 0.472 0.458
Hca051 9 0.832 0.844 4 0.536 0.583 10 0.831 0.667
Hca055 6 0.623 0.469 4 0.602 0.417* 5 0.617 0.417**
Hca057 9 0.791 0.688 2 0.457 0.292 5 0.537 0.435**
Hca062 7 0.771 0.688 6 0.668 0.542** 3 0.392 0.417
Hca065 13 0.813 0.688 5 0.666 0.609 4 0.463 0.417
Hca066 7 0.541 0.433 4 0.665 0.500** 3 0.457 0.417
Hca069 10 0.820 0.645 2 0.043 0.043 8 0.347 0.130**
Hca070 3 0.563 0.500 6 0.362 0.292** 3 0.223 0.250
Hca071 5 0.566 0.531 2 0.492 0.458 4 0.120 0.125
Hca072 7 0.721 0.700 3 0.385 0.125** 3 0.368 0.136**
Hca085 6 0.657 0.531 5 0.624 0.583 5 0.458 0.500
Hca086 4 0.539 0.594 2 0.444 0.417 3 0.119 0.125

n, number of individuals sampled; A, number of alleles; HE, expected heterozygosity; HO, observed heterozygosity.

a Significant deviation from Hardy-Weinberg equilibrium (*p < 0.05, **p < 0.01).

Table 4.
Results of cross-amplication and genetic properties of 28 microsatellite loci developed from Hosta capitata in H. minor and H.venusta.
Locus H. minor (n = 24) H. venusta (n = 24)


A HE HOa Sr (bp) A HE HOa Sr (bp)
Hca004 2 0.187 0.125 124–126 4 0.293 0.208** 124–130
Hca005 - - - - - - - -
Hca007 - - - - - - - -
Hca010 10 0.753 0.708 125–165 6 0.684 0.227** 123–155
Hca012 - - - - - - - -
Hca014 3 0.234 0.087** 183–195 5 0.596 0.409** 183–201
Hca017 6 0.550 0.625** 188–204 7 0.691 0.625** 190–204
Hca031 5 0.622 0.250 123–137 3 0.317 0.375 123–135
Hca033 - - - - - - - -
Hca037 2 0.499 0.708 160–163 2 0.486 0.583 160–163
Hca038 - - - - - - - -
Hca040 3 0.269 0.087** 156–162 4 0.588 0.000 154–160
Hca041 3 0.317 0.333 202–206 4 0.631 0.542* 202–216
Hca045 - - - - - - - -
Hca048 7 0.757 0.958** 254–268 8 0.804 0.304** 244–278
Hca050 - - - - - - - -
Hca051 - - - - - - - -
Hca055 4 0.563 0.250** 132–138 5 0.726 0.417** 132–140
Hca057 - - - - - - - -
Hca062 - - - - - - - -
Hca065 - - - - - - - -
Hca066 3 0.314 0.000** 255–271 4 0.734 0.529* 253–271
Hca069 - - - - - - - -
Hca070 2 0.496 0.217** 122–124 4 0.544 0.542** 122–142
Hca071 - - - - - - - -
Hca072 5 0.619 0.091** 198–224 3 0.322 0.261 198–228
Hca085 - - - - - - - -
Hca086 - - - - - - - -

n, number of individuals sampled; A, number of alleles; HE, expected heterozygosity; HO, observed heterozygosity; Sr, size range; -, unsuccessful amplification.

a Significant deviations from Hardy-Weinberg equilibrium (*p < 0.05 and **p < 0.01).

Literature Cited

The Angiosperm Phylogeny Group. Chase, MW. Christenhusz, MJM. Fay, MF. Byng, JW. Judd, WS. Soltis, DE. Mabberley, DJ. Sennikov, AN. Soltis, PS and Stevens, PF. 2016. An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG IV. Botanical Journal of the Linnean Society 181: 1-20.
crossref pdf
Chen, X and David, EB. 2000. Hosta. In Flora of China, Vol. 24. Flagellariaceae through Marantaceae. Wu, ZY. Raven, PH (eds.), Science Press, Beijing and Missouri Botanical Garden Press, St Louis, MO. Pp. 204-205.

Chung, MG. 1990. A biosystematics study of the genus Hosta Tratt. (Liliaceae/Funkiaceae) in Korea. PhD dissertation. University of Georgia; Athens, GA, USA. 370.

Chung, MG. 1994. Genetic structure in Korea populations of Hosta capitata (Liliaceae). Journal of Plant Biology 37: 277-284.

Chung, MG. Jones, SB. Hamrick, JL and Chung, HG. 1991. Morphometric and isozyme analysis of the genus Hosta (Liliaceae) in Korea. Plant Species Biology 6: 55-69.
crossref
Chung, YC. 2018. Hosta. In The Genera of Vascular Plants of Korea. Flora of Korea Editorial Committee (ed.), Academy Publishing Co, Seoul. Pp. 1734-1737 (in Korean).

Crisp, MD. Trewick, SA and Cook, LG. 2011. Hypothesis testing in biogeography. Trends in Ecology and Evolution 26: 66-72.
crossref
Donoghue, MJ and Edwards, EJ. 2014. Biome shifts and niche evolution in plants. Annual Review of Ecology, Evolution, and Systematics 45: 547-572.
crossref
Fujita, N. 1975. The genus of Hosta (Liliaceae) in Japan. Acta Phytotaxonomica et Geobotanica 27: 66-96.

Jo, H and Kim, M. 2017. A taxonomic study of the genus Hosta in Korea. Korean Journal of Plant Taxonomy 47: 27-45 (in Korean).
crossref pdf
Jones, SB. 1989. Hosta yingeri (Liliaceae/Funkiaceae): a new species from Korea. Annals of Missouri Botanical Garden 76: 602-604.
crossref
Lee, J.-Y. Wang, B. Wheeler, MC. Fu, X. Waliser, DE and Kang, I-S. 2013. Real-time multivariate indices for the boreal summer intraseasonal oscillation over the Asian summer monsoon region. Climate Dynamics 40: 493-509.
crossref
Lee, JS. Kim, SY. Yang, JC. Lee, KC. Lee, SY. Ko, CH. Choi, H. Ryu, SH and Yoon, SM. 2018. Hostas in Korea. Korea National Arboretum Press, Pocheon. Pp. 417 (in Korean).

Maekawa, F. 1940. The genus Hosta . Journal of Faculty of Science, Imperial University of Tokyo, Section III Botany 5 317-425.

Miller, MP. Knaus, BJ. Mullins, TD and Haig, SM. 2013. SSR_pipeline: a bioinformatic infrastructure for identifying microsatellite from paired-end Illumina high-throughput DNA sequencing data. Journal of Heredity 104: 881-885.
crossref pdf
Park, KB and Chung, MG. 1997. Indirect measurement of gene flow in Hosta capitata (Liliaceae). Botanical Bulletin of Academia Sinica 38: 267-272.

Peakall, R and Smouse, PE. 2005. GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: 288-295.
crossref
Qian, H and Ricklefs, RE. 2000. Large-scale processes and the Asian bias in species diversity of temperate plants. Nature 407: 180-182.
crossref pdf
Qiu, GY. Yin, J. Tian, F and Geng, S. 2011. Effects of the “conversion of cropland to forest and grassland program” on the water budget of Jinghe river catchment in China. Journal of Environmental Quality 40: 1745-1755.
crossref
Rousset, F. 2008. GENEPOP’ 007: a complete re-implementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8: 103-106.
crossref
Rozen, S and Skaletsky, H. 2000. Primer 3 on the WWW for general users and for biologist programmers. Methods in Molecular Biology 132: 365-386.

Sakaguchi, S. Kimura, T. Kyan, R. Maki, M. Nishino, T. Ishikawa, N. Nagano, AJ. Honjo, MN. Yasugi, M. Kudoh, H. Li, P. Choi, HJ. Chernyagina, OA and Ito, M. 2018. Phylogeographic analysis of the East Asian goldenrod (Solidago virgaurea complex, Asteraceae) reveals hidden ecological diversification with recurrent formation of ecotypes. Annals of Botany 121: 489-500.
crossref pdf
Sauve, RJ. Zhou, S. Yu, Y and Schmid, WG. 2005. Randomly amplified polymorphic DNA analysis in the genus Hosta . HortScience 40: 1243-1245.
crossref
Schmid, WG. 1991. The Genus Hosta: Giboshi Zoku. Timber Press, Portland. Pp. 428.

Tamura, MN and Fujita, N. 2016. Hosta Tratt. In Flora of Japan. Vol. IVb. Angiospermae Monocotyledoneae (b). Iwatsuki, K. Boufford, DE. Ohba, H (eds.), Kodansha LTD, Tokyo. Pp. 140-147.

Van Oosterhout, C. Hutchinson, WF. Wills, DPM and Shipley, P. 2004. MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535-538.
crossref
Editorial Office
Korean Journal of Plant Taxonomy
Department of Biology, Daejeon University, Daejeon 34520, Korea
TEL: +82-42-280-2434   E-mail: kjpt1968@gmail.com
About |  Browse Articles |  Current Issue |  For Authors and Reviewers
Copyright © Korean Society of Plant Taxonomists.                 Developed in M2PI