| Home | E-Submission | Sitemap | Editorial Office |  
top_img
Korean J. Pl. Taxon > Volume 47(1); 2017 > Article
Lee, Cho, Yang, Han, Lyu, Kim, Moon, and Choi: Development and characterization of 21 microsatellite markers in Daphne kiusiana, an evergreen broad-leaved shrub endemic to Korea and Japan

Abstract

Microsatellite markers were isolated for Daphne kiusiana var. kiusiana (Thymelaeaceae), an evergreen broad-leaved shrub endemic to Korea and Japan. Because its populations in Jeju Island are morphologically controversial, and consistently threatened by anthropogenic pressures, taxonomic delimitation and conservation effort are required at the genetic level. We developed 21 polymorphic microsatellite loci from Next Generation Sequencing data. The primer set included di-, tri-, and tetra-nucleotide repeats. Variability in the markers was tested for 80 individuals of D. kiusiana from three natural populations in Jeju Island and Japan. Among the 21 loci, three were unavailable for population JKJU of Japan. The Neighbor-Joining tree based on microsatellite markers described here classified the three populations into two groups according to geographical or morphological traits. These will be a powerful genetics tool for determining the taxonomic boundary and establishing suitable conservation strategies for D. kiusiana in Jeju Island.

Approximately 2,000 islands are found in a narrow band along the southern coastal region of Korean Peninsula including Jeju Island (Yang, 2013). This edge zone is disjunctively located on the northwestern margin of an equivalent climatic area of Japan, and is covered by various evergreen broad-leaved tree species (Satake et al., 1989; Lee and Choi, 2010). Thus, Korean populations of a given species may have an important evolutionary property (J.-H. Lee et al., 2013; Lee et al., 2014) that has guaranteed their long-term survival in East Asia (Frankham, 2005; Ouborg et al., 2006; Willi et al., 2006).
Daphne kiusiana Miq. var. kiusiana is an evergreen broad-leaved shrub endemic to Korea (mostly on Jeju Island) and Japan. However, plants on Jeju Island are sometimes regarded as a different species with D. kiusiana in Japan because of several unique morphological traits, e.g., a glabrous calyx and lobes, and elliptical leaves (c.f., D. jejudoensis M. Kim) (J.
Lee et al., 2013). Therefore, a clearer boundary of taxonomic delimitation is needed. Moreover, natural populations in Korea are threatened by anthropogenic pressures, i.e., disturbances that have caused habitat destruction due to urbanization as well as over-collecting of specimens for commercial purposes (Ro et al., 2010). For example, because of its graceful shape (resembling a bride's bouquet) and pleasant fragrance, it is commonly used as an ornamental (Ro et al., 2010). Populations there are now extremely restricted to several islands, including Geoje and Jeju, where plants are being managed as endangered organisms (Korea National Arboretum, 2008). Despite these protective measures, human activity continues to threaten their existence. Therefore, we developed a set of polymorphic microsatellite markers from D. kiusiana to resolve this debate about the taxonomic entity of Jeju populations and establish a suitable conservation strategy for Korean populations based on genetic diversity and structure.

Materials and Methods

To acquire our microsatellite library, we used a DNeasy Plant Mini Kit (Qiagen, Seoul, Korea) to extract genomic DNA from a fresh leaf of a single plant sampled at Sinpyeonggotjawal, Jeju Island, Korea (Table 1). Measurements were made with a NanoDrop ND-1000 (NanoDrop Technologies, Wilmington, DE, USA). Applying a Next Generation Sequencing (NGS) approach, we sequenced high-quality DNA (concentration: 46 ng/µL; A260/280 = 1.73; A260/230 = 1.64) using the Illumina MiSeq platform (LAS, Seoul, Korea). In all, 4,936,656 reads (2 × 300 bp) were produced by Illumina paired-end sequencing and then trimmed by Trimmomatic 0.32 (Bolger et al., 2014).
To identify the microsatellites from those reads, we screened them with SSR pipeline v. 0.951 (Miller et al., 2013). The parameters were set for detection of di-, tri-, or tetra-nucleotide motifs with flanking regions larger than 50 bp and having at least 10, 6, or 4 repeats, respectively. From this screening, we acquired 28,495 sequences that were then re-filtered in an attempt to reference-map all of the reads to each microsatellite that contained a singleton. This was accomplished with Geneious R7.1.8 (Biomatters; available from http://www.geneious.com). After discarding putative multi-copy loci with exceptionally high coverage, we selected fragments with unique patterns that had two separate alleles, few variations at the site to which a primer was attached, and no additional single nucleotide polymorphisms in the flanking region. Finally, we designed 140 primer pairs with Primer3 in Geneious R7, and synthesized with a taq sequence (5′-CACGACGTTGTAA AACGAC-3′) to enable incorporation with M13 primer labeled at the 5'-end with a 6-FAM fluorescent dye.
To test the effectiveness of the developed microsatellite loci, we collected 80 individuals of D. kiusiana from three natural populations in Korea and Japan (Table 1). To minimize the damage to this study species, only one plant per population was taken to prepare a voucher specimen that was then deposited in the herbarium at the Korea Institute of Oriental Medicine (KIOM). The DNA was extracted as described above, and PCR was conducted with a GeneAmp® PCR System 2700 Thermal Cycler (Applied Biosystems, Foster City, CA, USA), using a final volume of 10 μL that comprised 15 to 20 ng of extracted DNA, 5 µL of SolgTM 2× Taq PCR Smart-Mix I (Solgent, Daejeon, Korea), 0.01 µM forward primer, 0.2 µM reverse primer, and 0.1 µM of the M13 primer (fluorescently labeled). The PCR amplifications were performed under the following conditions: initial denaturation at 95 oC for 2 min; then 30 cycles of denaturing at 94 oC for 30 s, annealing at 53 to 58 oC for 45 s, and extension at 72 oC for 45 s; with a final extension at 72 oC for 7 min. Without dilution of fluorescently labeled PCR products, 1 µL was analyzed concurrently with the GeneScanTM-500LIZTM Size Standard (Applied Biosystems) on an ABI 3730XL sequencer (Applied Biosystems). Allele sizes were manually determined three times with GENEMAPPER 3.7 software (Applied Biosystems). The number of alleles plus values for HE (expected heterozygosity) and HO (observed heterozygosity) were obtained with GenAlEx 6 (Peakall and Smouse, 2006). Deviations from Hardy–Weinberg equilibrium (HWE) was estimated with GENEPOP 4.0 (Rousset, 2008).
To determine the genetic association among the three populations, we quantified their relationship using a proportion of shared alleles (Dps) based on 19 loci. Only DKi134 and DKi140 were excluded. The pair-wise genetic distance (Dps) was generated with MSA software (Dieringer and Schlöterer, 2003) using a bootstrap analysis of 1,000 replicates. From these distance matrices, we constructed 50% consensus trees by the Neighbor-Joining (NJ) method, as implemented in PHYLIP ver. 3.68 (Felsenstein, 2004).

Results and Discussion

Of the developed 140 primer pairs, 21 proved to be polymorphic while the rest either were insufficiently amplified
or else produced inconsequential peaks (Table 2). Overall, the alleles numbered 2 to 7 (average of 3.90). Values for HE and HO ranged from 0.000 to 0.601 and from 0.000 to 0.700, respectively (Table 3). Among the 21 loci, two and nine were monomorphic in Jeju population KJSE and Japanese population JKJU, respectively. Loci DKi134 and DKi140 were not amplified in the Japanese population. Furthermore, nine polymorphic and monomorphic loci clearly did not overlap between Jeju Island and Japan within the size range of those alleles (Table 3). Although eight loci showed significant deviations from Hardy–Weinberg equilibrium, this was not consistent across populations. The NJ tree classified the three populations into two groups according to geographical or morphological traits (Jeju Island vs. Japan) with a remarkably high bootstrap value of 100 (Fig. 1). The microsatellite markers described here will be a powerful genetics tool for elucidating the taxonomic entity of Jeju populations, and in the organization of conservation programs planned to reduce inbreeding via artificial crossbreeding and to minimize loss of genetic variability in Jeju populations. Also, we expect that they will also improve our understanding about historical and contemporary gene flow, not only on a fine scale within Korea but also on a larger scale across the entire range of this species.
Table 1.
Voucher and location information for Daphne kiusiana samples used in this study. One specimen per population was deposited in the herbarium at the Korea Institute of Oriental Medicine (KIOM).
Voucher no. Locality Geographic coordinates No. of individuals
LJH_KIOM-2015-4 Sinpyeonggotjawal, Jeju Island, Korea (KJSI) 33°16′ N, 126°15′ E 1
LJH_KIOM-2015-5 Cheongsugotjawal, Jeju Island, Korea (KJCH) 33°18′ N, 126°16′ E 30
YSG_KIOM-2016-40 Seonheulgotjawal, Jeju Island, Korea (KJSE) 33°31′ N, 126°42′ E 28
LJH_KIOM-2015-58 Juboyama, Kyushu, Japan (JKJU) 33°28′ N, 130°04′ E 22
Table 2.
Characteristics of 21 microsatellite loci developed in Daphne kiusiana.
Locus Primer sequence (5′–3′)a Repeat
motif
A Tm (°C) Size
range (bp)
GenBank
accession No.
DKi019 F: CCTAATGATTTAGACCGCT (CT)12 5 53 206–232 KT932539
R: TTCTGGTGAGAAACGAAC
DKi020 F: GTACAGATCTCAATTGGTCT (CT)13 4 53 244–252 KT932540
R: GATAGCAATCATCCATCAAG
DKi021 F: CGTTTAGGGTGTAAGTCATA (CT)16 7 53 267–285 KT932541
R: TACTCGATCCATCCCTATTA
DKi022 F: CAGAGACAGGATTGAACAT (GA)13 6 53 197–215 KT932542
R: ATTGGATACGTGTTAGGTC
DKi023 F: CAGTTGAGGATGTCATATCA (GA)13 6 53 279–293 KT932543
R: GCCGAATGTGTTATTTGTC
DKi101 F: AGATGCTGGTTCATGTTCG (AC)10 5 53 179–193 KT932572
R: GGAACACAGTTGAACGTTG
DKi104 F: CCTGCGATCTGGGTAATTT (AT)10 4 58 239–251 KT932574
R: AGGCCACACAACAAGAATC
DKi062 F: ATCAACAATCTACTCCTGC (ATG)8 4 53 247–262 KT932553
R: CACTCCTTCCAGAACTAAG
DKi070 F: AGAAGATGATGCCAAGATG (GAA)9 4 58 245–254 KT932557
R: GGAAGACTTAACGGCTAAT
DKi072 F: AAGGTGGGAGATTCTGATA (GAT)8 2 53 199–205 KT932558
R: GAGCACTAGACAATTCCTT
DKi073 F: GTCTTAGGGCTAGTGATTC (GAT)9 3 53 248–263 KT932559
R: GACCGTCAAGTCTTCTATT
DKi082 F: TCAAGACCAATATTGCCAG (TGA)8 4 53 183–201 KT932564
R: CTCCATGAGGTGATTCATT
DKi117 F: ATAGTTCTTGTGCCACCAC (ATA)6 2 53 263–266 KT932579
R: TAGCCAAGTCGTTGTCTTG
DKi119 F: AAGCACAATCATGGAGCAT (CTT)6 7 53 172–208 KT932580
R: ATCGTCAGAACTAGCCTGA
DKi091 F: TGAGAGACTCAGTACTCTC (AGAA)5 3 53 309–317 KT932569
R: ACTACCACTCTCTGTTTCT
DKi097 F: ACTTGTCCTCAACTTTCTC (TTAA)5 3 53 242–258 KT932571
R: TATTTGATGATCAGGTCGC
DKi128 F: ATAAAGCGGAATGGAGTCG (TTGA)7 3 53 179–187 KT932585
R: ACAGTAGTAGGTCCCACAC
DKi129 F: AGTTCAGACGCTTCAACC (CATA)6 4 58 296–312 KT932586
R: CCATCCACAGAGACAGATTC
DKi131 F: GAAACTCGTCTCTCTTCCTC (AGGA)5 2 53 199–203 KT932588
R: GACGACTACCATAGCATAGC
DKi134 F: AGTGCTTTAATGGAAGGCT (CTAT)4 2 58 203–223 KT932589
R: GATCACCTCCTAACCAAGC
DKi140 F: ATTCACACCCTAGTCGGAT (TGTA)4 2 53 215–219 KT932590
R: GAAACAAAGCTGAGCGAAG

A, number of alleles; Tm, PCR annealing temperature.

a All forward primers were M13 (5′-CACGACGTTGTAAAACGAC-3′)–tailed at the 5′-end.

Table 3.
Genetic parameters of 21 microsatellite loci for separate populations of Daphne kiusiana sampled in Jeju Island (KJCH and KJSE) and Japan (JKJU).
Locus KJCHa (n = 30)
KJSEa (n = 28)
JKJUa (n = 22)
A HE HO Sr A HE HO Sr A HE HO Sr
DKi019 2 0.500 0.467 216–218 2 0.436 0.429 216–218 3 0.458 0.136* 206–232
DKi020 2 0.095 0.100 244–248 2 0.035 0.036 248–250 3 0.241 0.273 248–252
DKi021 5 0.537 0.600 275–285 4 0.198 0.143* 275–285 2 0.434 0.000* 267–269
DKi022 3 0.493 0.467 197–213 3 0.601 0.643* 197–201 2 0.351 0.091* 211–215
DKi023 3 0.443 0.300 287–293 2 0.459 0.571 287–291 3 0.507 0.091* 279–283
DKi101 3 0.259 0.200* 179–183 2 0.163 0.107 179–181 2 0.351 0.091* 189–193
DKi104 3 0.509 0.433 245–251 2 0.226 0.185 245–249 1 0.000 0.000 239
DKi062 2 0.498 0.467 259–262 2 0.219 0.250 259–262 2 0.044 0.045 247–256
DKi070 3 0.513 0.700 245–254 2 0.494 0.464 245–251 1 0.000 0.000 248
DKi072 2 0.444 0.467 199–205 2 0.293 0.286 199–205 1 0.000 0.000 205
DKi073 3 0.496 0.433* 248–263 2 0.436 0.357 248–254 1 0.000 0.000 248
DKi082 2 0.064 0.067 195–198 3 0.070 0.071 195–201 1 0.000 0.000 183
DKi117 2 0.339 0.233 263–266 2 0.484 0.464 263–266 1 0.000 0.000 263
DKi119 4 0.585 0.567 172–208 4 0.284 0.321 178–208 3 0.433 0.545 193–199
DKi091 2 0.406 0.433 313–317 2 0.357 0.393 313–317 1 0.000 0.000 309
DKi097 2 0.278 0.133* 242–250 2 0.316 0.250 242–250 1 0.000 0.000 258
DKi128 3 0.415 0.367 179–187 2 0.497 0.357 183–187 2 0.044 0.045 179–183
DKi129 2 0.206 0.233 308–312 1 0.000 0.000 308 2 0.397 0.545 296–304
DKi131 2 0.480 0.267* 199–203 2 0.499 0.464 199–203 1 0.000 0.000 203
DKi134 2 0.444 0.333 203–223 2 0.494 0.607 203–223 0 N/A N/A N/A
DKi140 2 0.095 0.100 215–219 1 0.000 0.000 219 0 N/A N/A N/A

A, number of alleles; HE, expected heterozygosity; HO, observed heterozygosity; Sr, size range; N/A, unavailable PCR products.

* Significant deviations from Hardy-Weinberg equilibrium (P < 0.05).

a Population symbols are the same as those used in parentheses for Table 1.

Fig. 1.
Neighbor-Joining tree for 3 populations of D. kiusiana in Jeju Island and Japan based on proportion of shared alleles (Dps). Colored circles on branch tips indicate number of individuals for each population. Bootstrap support at internodes is shown if value is >50 %.
kjpt-47-1-6f1.gif

ACKNOWLEDGMENTS

Acknowledgments The authors thank two colleagues Choi IS and Jin DP at the Plant Systematics Laboratory of Inha University for help in assisting with statistical analysis. This work was supported by the National Research Foundation of Korea (NRF) (No. NRF-2016R1C1B2012150), and a basic grant (K16401) for the K-herb Research Center, Korea Institute of Oriental Medicine.

Literatures Cited

Bolger, A. M.. Lohse, M. and Usadel, B.. 2014. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 30: 2114-2120.
crossref pmid pmc
Dieringer, D. and Schlötterer, C.. 2003. Microsatellite Analyser (MSA): A platform independent analysis tool for large micro-satellite data sets. Molecular Ecology Notes 3: 167-169.
crossref
Felsenstein, J.. 2004. PHYLIP: Phylogeny inference package. Department of Genome Sciences and Department of Biology, University of Washington, Seattle, WA.

Frankham, R.. 2005. Genetics and Extinction. Biological Conservation 126: 131-140.
crossref
Korea National Arboretum. 2008. Rare Plants Data Book in Korea. Korea National Arboretum, Pocheon. 332 (in Korean).

Lee, J.-H. and Choi, B.-H.. 2010. Distribution and northernmost limit on the Korean Peninsula of three evergreen trees. Korean Journal of Plant Taxonomy 40: 267-273.

Lee, J.-H.. Lee, D.-H. and Choi, B.-H.. 2013. Phylogeography and genetic diversity of East Asian Neolitsea sericea (Lauraceae) based on variations in chloroplast DNA sequences. Journal of Plant Research 126: 193-202.
crossref pmid
Lee, J.-H.. Lee, D.-H.. Choi, I.-S. and Choi, B.-H.. 2014. Genetic diversity and historical migration patterns of an endemic evergreen oak, Quercus acuta, across Korea and Japan, inferred from nuclear microsatellites. Plant Systematics and Evolution 300: 1913-1923.
crossref
Lee, J.. Lee, K.-H.. So, S.. Choi, C. and Kim, M.. 2013. A new species of Daphne (Thymelaeaceae): D. jejudoensis M. Kim. Korean Journal of Plant Taxonomy 43: 94-98.
crossref
Miller, M. P.. Knaus, B. J.. Mullins, T. D. and Haig, S. M.. 2013. SSR pipeline: A bioinformatics infrastructure for identifying microsatellites from paired-end Illumina high-throughput DNA sequencing data. Journal of Heredity 104: 881-885.
crossref pmid
Ouborg, N. J.. Vergeer, P. and Mix, C.. 2006. The rough edges of the conservation genetics paradigm for plants. Journal of Ecology 94: 1233-1248.
crossref
Peakall, R. and Smouse, P. E.. 2006. GenAlEx 6: Genetic Analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: 288-295.
crossref
Rousset, F.. 2008. GENEPOP’007: A complete reimplementation of the genepop software for Windows and Linux. Molecular Ecology Resources 8: 103-106.
crossref pmid
Ro, N. Y.. Song, E. Y.. Kim, S. C.. Ko, H. C. and Lee, S. Y.. 2010. Propagation of a rare variety Daphne kiusiana Miq. in Korea through softwood cuttings. Journal of Bio-Environment Control 19: 246-250 (in Korean).

Satake, Y.. Hara, H.. Watari, S. and Tominari, T.. 1989. Wild Flowers of Japan: Woody Plants. Heibonsha, Tokyo. 300 pp.

Willi, Y.. Van Buskirk, J. and Hoffmann, A. A.. 2006. Limits to the adaptive potential of small populations. Annual Review of Ecology. Evolution, and Systematics 37: 433-458.
crossref
Yang, S. J.. 2013. The distribution analysis for the flora of uninhabited islands in the Gyeongsangnamdo. MS thesis. Changwon National University; Changwon, Korea. 87 (in Korean).

Editorial Office
Korean Journal of Plant Taxonomy
Department of Biology, Daejeon University, Daejeon 34520, Korea
TEL: +82-42-280-2434   E-mail: kjpt1968@gmail.com
About |  Browse Articles |  Current Issue |  For Authors and Reviewers
Copyright © Korean Society of Plant Taxonomists.                 Developed in M2PI