| Home | E-Submission | Sitemap | Editorial Office |  
top_img
Korean J. Pl. Taxon > Volume 50(1); 2020 > Article
/home/virtual/kjpt/journal//../xmls/kjpt-50-1-22.xml SHIN, KIM, KIM, LEE, and KIM: Development of EST-SSR markers for the Korean endemic species Chrysosplenium aureobracteatum (Saxifragaceae)

Abstract

Chrysosplenium aureobracteatum Y. I. Kim & Y. D. Kim (Saxifragaceae) is a recently described endemic species growing in the central part of the Korean peninsula. It requires constant monitoring for conservation due to its limited distributions. There is also a need for molecular markers for proper assessments of the genetic differentiation of C. aureobracteatum from species morphologically similar to it. In this study, we developed microsatellite markers that can be used to evaluate the genetic diversity of this species, representing fundamental data with which to conserve the natural populations of the species. A total of 17 expressed sequence tag–simple sequence repeat (EST-SSR) markers were developed by the Illumina pair-end sequencing of the transcriptomes of C. aureobracteatum. These markers were successfully applied to populations of C. aureobracteatum and to its most closely related species, C. barbatum, revealing high polymorphism in both species. The EST-SSR markers developed in this study were proven to be useful not only to monitor the population genetic structure of C. aureobracteatum for conservation purposes but also to study the genetic delimitation of the species from species closely related to it.

Chrysosplenium aureobracteatum Y. I. Kim & Y. D. Kim (Saxifragaceae) is a recently described species only growing in the central part of the Korean peninsula (Kim and Kim, 2015). The recognition of the species as a separate taxon has long been hampered due to the lack of prominent diagnostic traits during the flowering period, causing many researchers to misidentify it as either C. barbatum Nakai, C. fulvum A. Terracc., or C. sphaerospermum Maxim. (Kim, 2014). Kim and Kim (2015) noted the shape of the leaves on the sterile stems which developed after the flowering period as the most reliable diagnostic character for the above species, which are morphologically very similar to each other (Hara, 1957).
C. aureobracteatum requires constant monitoring in terms of conservation due to its limited distribution only in northeastern Gyeonggi-do and northwestern Gangwon-do in South Korea. Genetic diversity data of populations is used as a key component for the establishment of conservation plans for rare endemic species (Solórzano et al., 2016; Jung et al., 2018). Although the species is well segregated from taxa closely resembling it in the internal transcribed spacer phylogeny (Kim, 2014), population genetic data would be important for understanding the evolutionary history and for clarifying the taxonomic delimitation of these species. Expressed sequence tag–simple sequence repeat (EST-SSR) markers developed from the RNAs of the expressed genes have relatively conservative characteristics (Ellis and Burke, 2007; Hu et al., 2011), making them useful not only for population genetic studies but also for investigations of the evolutionary relationships among closely related species (Balbino et al., 2019). In this study, EST-SSR markers based on the transcriptome data of C. aureobracteatum were developed to evaluate the genetic diversity of this newly described species.

Materials and Methods

RNA was extracted from the fresh leaves of an individual of Chrysosplenium aureobracteatum plant sampled from Gwangdeoksan Mt. (Voucher No. KYI_2014358) (Table 1) using a RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA). The extracted RNA was used for a cDNA synthesis using a TruSeq cDNA Library Prep Kit, version 2 (Illumina, San Diego, CA, USA). The synthesized cDNA library was used for Illumina Hiseq 100 bp paired-end de novo transcriptome sequencing. Raw reads acquired by RNA sequencing were subjected to quality checking and trimming using Trimmomatic 0.32 (Bolger et al., 2014). EST-SSR motifs were obtained from the trimmed data using the Trinity (Hass et al., 2013) and the MIcroSAtellite (MISA) identification tools (Thiel et al., 2003). Primer sets were constructed to amplify the selected EST-SSR motifs using the Primer3 program (Rozen and Skaletsky, 1999). EST-SSR candidate loci (markers) were selected based on the number of SSR motif repetitions (5–8 times), the PCR product size (100–300 bp), the coverage depth (20–110), and the primer annealing temperature (55–60°C).
The candidate EST-SSR markers developed from C. aureobracteatum were applied to its most closely related species, C. barbatum, to confirm and obtain markers exhibiting polymorphism in both species. We examined 20 individuals of Chrysosplenium aureobracteatum and C. barbatum for the marker evaluation and cross-specific amplification test. The voucher specimens were deposited in the HHU (Herbarium of Hallym University) in Korea (Table 1).
PCR for the selected loci was conducted using a mixture with a total volume of 25 μL consisting of 10× Ex Taq buffer at 2.5 μL (TaKaRa Bio Inc., Otsu, Japan), 2.5 mM dNTP at 2 μL, 10 pmol forward and reverse primer labeled with fluorescent dye (FAM, HEX, NED) each at 0.5 μL, template DNA (5–10 ng) at 2 μL, Ex Taq DNA polymerase at 0.12 μL and SIGMA free water using a GeneAmp PCR System 9700 thermocycler (Applied Biosystems Inc., San Diego, CA, USA). The PCR process was performed under the following conditions: pre-denaturation (98°C, 5 min), denaturation (95°C, 1 min), annealing (59°C, 1d min), and extension (72°C, 1 min 30 sec). After going through the above reaction 35 times, the final extension was processed (72°C, 10 min). The PCR products were electrophoresed at 110 V in 1.2% agarose gel for 90 min, stained with ethidium bromide, and confirmed using a UV illuminator. Alleles were identified with an ABI 3730XL (automated sequencer) equipped with the GeneScan 500 LIZ Size Standard (Applied Biosystems). Genotyping was performed using GeneMapper 3.7 (Applied Biosystems), and peaks were scored manually by visual inspections. The PCR products with sizes deviating from the expected size ranges (as estimated by the Primer3 program) were eliminated from the genotyping process. Finally, the resulting genotypes were encoded to calculate the number of alleles (A), the observed heterozygosity (Ho), and the expected heterozygosity (He) using the GenAlEx 6.5 (Peakall and Smouse, 2012).

Results and Discussion

As a result of RNA sequencing, raw data of 8,486,210,570 bp were generated (GenBank BioProject number: PRJNA606349). The raw data were processed to produce 7,818,963,245 bp of trimmed data, with this data then utilized to produce a total of 70,753,963 bp of transcriptome data. A total of 15,547 SSR motifs were identified from the trimmed data. The identified SSR motifs consisted of 40% mono-nucleotides, 36% dinucleotides, 23% tri-nucleotides, and 1% tetra-, penta-, and hexa-nucleotides (Table 2).
From the identified SSR motifs, 96 candidate markers were selected in consideration of the number of repetitions, the coverage depth, the annealing temperature, and the PCR product size. Excluding nonspecific bands with sizes deviating from the expected sizes, a total of 17 EST-SSR loci (markers) showing polymorphisms for Chrysosplenium aureobracteatum and C. barbatum were finally developed (Table 3).
As a result of applying the 17 EST-SSR markers on a population (with 20 individuals) of C. aureobracteatum, polymorphisms were detected from 11 markers, and a total of 33 alleles were identified (2 to 7 alleles depending on the polymorphic markers). The observed heterozygosity (Ho) and the expected heterozygosity (He) ranged from 0.000 to 0.750 and 0.000 to 0.543, respectively.
Cross-specific amplification for a population (with 20 individuals) of C. barbatum confirmed that 13 markers were polymorphic out of 15 amplifiable markers, resulting in a total of 47 alleles (2 to 8 alleles depending on the polymorphic markers). The observed heterozygosity (Ho) and the expected heterozygosity (He) ranged 0.000 to 0.850 and 0.000 to 0.779, respectively (Table 4).
It is important to note that the six monomorphic markers in C. aureobracteatum (CA_005, CA_006, CA_010, CA_052, CA_066, CA_104) were highly polymorphic in C. barbatum. In contrast, the monomorphic markers for C. barbatum (CA_056, CA_073) exhibited polymorphism in C. aureobracteatum (Table 4). These results suggest that the EST-SSR markers developed for C. aureobracteatum are useful not only to examine the population genetic structure but also for species delimitation among related taxa.

ACKNOWLEDGMENTS

This work was supported by a grant from the National Research Foundation of Korea (2015R1D1A1A01057163).

NOTES

Conflict of Interest
Young-Dong Kim, a contributing editor of the Korean Journal of Plant Taxonomy, was not involved in the editorial evaluation or decision to publish this article. All remaining authors have declared no conflicts of interest.

Table 1.
Locality and voucher information for the Chrysosplenium aureobracteatum and C. barbatum populations examined in this study. Voucher specimens were deposited in the HHU.
Taxon Locality No. Voucher No.
C. aureobracteatum Hwacheon, Gangwon-do (Gweongdeoksan Mt.) 20 KYI_2014358
C. barbatum Wonju, Gangwon-do (Chiaksan Mt.) 20 KYI_2014271

No., number of individuals sampled.

Table 2.
Types and ratios of SSR motifs identified in Chrysosplenium aureobracteatum.
Unit size No. of SSRs (%)
Mononucleotide 6,260 (40.27)
Dinucleotide 5,531 (35.58)
Trinucleotide 3,593 (23.11)
Tetranucleotide 133 (0.86)
Pentanucleotide 18 (0.12)
Hexanucleotide 12 (0.08)
Table 3.
Information on 17 EST-SSR loci selected from Chrysosplenium aureobracteatum.
Locus Primer sequence (5′-3′) Repeat motif Allele size range (bp) GenBank accession No.
CA003 F:TCTGGTGCCAAATCTCACAA (AG)7 191–231 MN961272
R:CGATCTCTGGTCCGAGGTC
CA005 F:AGAAGCAGAAGCAGGATCGG (TC)7 209–221 MN961273
R:CTCGAATCAATAATTGAAGATCTGA
CA006 F:CTCATTGCAGCTCAAAACCCA (AG)8 213–239 MN961274
R:CAGTAATCTCTGTCTCTCTTTCCA
CA008 F:TACCAGAGAATGCCGTGAGC (TC)7 210–218 MN961275
R:CGTCTTTCACCAGCCAAAACA
CA010 F:TGCTCTTTGCTCTCACCAGG (GA)7 225–233 MN961276
R:ATAATCCCGTCCGTCAAGGG
CA017 F:TCCGTCGAGCTTTTGGTCAA (AT)8 244–256 MN961277
R:TGGTCCCTTCAATCCCCAAC
CA052 F:CTCTCTCATACCTTCCCGGC (TC)7 278–296 MN961278
R:CCTGACATCATCCCAGCGAA
CA056 F:AGAAGACACTTGTTGCCTGA (AAG)5 215–221 MN961279
R:TTTGCCCTCGCCAATTGTTG
CA060 F:ACAAGGCTGCAACCCAAAAC (CCG)5 270–294 MN961280
R:TCGAGAGGCCGATCGTAGTA
CA063 F:TGGTGCTTGGAGATAACCCA (TTG)6 201–216 MN961281
R:GAGGCTTGGCAATGCAAACA
CA066 F:TGACGGGTCCAAATCGTCAA (CCA)6 211–229 MN961282
R:GAGAGGAGGTGGTGGTGTTG
CA073 F:TCCTCATCCACAGCAAGCTT (CTT)5 266–275 MN961283
R:AGTGCGAGTGAAAAGAGCGA
CA076 F:TCGTTGTCGCTACTGCTACC (TTC)5 209–230 MN961284
R:CCACCTGAGCAGTCACAAGA
CA080 F:GCGAATAACGAAACGGACCG (GAT)5 345–372 MN961285
R:ACAGACAAGCAGCGGTAAGA
CA091 F:ATCTCACCGTCGATTCAGCC (GAA)5 207–222 MN961286
R:CCGGAGTTCGAACATCACCT
CA092 F:TGGTCTCTCTAATCCGTGCC (TTC)5 257–272 MN961287
R:CATGCACAATCGGAAGCGTT
CA104 F:TCCAGTTCCAAAGACCACCC (AGC)5 197–209 MN961288
R:CAGCCCGCTAGTCAAAATGC
Table 4.
Genetic diversity in Chrysosplenium aureobracteatum and C. barbatum based on 17 developed microsatellite markers (loci).
Locus C. aureobracteatum (n = 20) C. barbatum (n = 20)

A Ho Hea A Ho Hea
CA_003 2 0.350 0.289 5 0.250 0.721***
CA_005 1 0.000 0.000 5 0.550 0.725
CA_006 1 0.000 0.000 5 0.650 0.779**
CA_008 2 0.350 0.349 - - -
CA_010 1 0.000 0.000 3 0.250 0.224
CA_017 4 0.750 0.543 - - -
CA_052 1 0.000 0.000 4 0.800 0.674*
CA_056 2 0.000 0.095*** 1 0.000 0.000
CA_060 2 0.150 0.139 4 0.400 0.586**
CA_063 3 0.600 0.621 3 0.500 0.454*
CA_066 1 0.000 0.000 3 0.700 0.564
CA_073 3 0.550 0.484 1 0.000 0.000
CA_076 2 0.050 0.049 3 0.850 0.559*
CA_080 2 0.500 0.495 2 0.750 0.469**
CA_091 3 0.150 0.224 2 0.550 0.489
CA_092 2 0.250 0.219 3 0.400 0.339
CA_104 1 0.000 0.000 3 0.700 0.611

n, number of individuals; A, number of alleles; Ho, observed heterozygosity; He, expected heterozygosity; - unamplified.

a Significant deviation from Hardy-Weinberg equilibrium

{ label (or @symbol) needed for fn[@id='tfn4-kjpt-50-1-22'] } (*p < 0.05, **p < 0.01, ***p < 0.0001).

Literature Cited

Balbino, E. Martins, G. Morais, S and Almeida, C. 2019. Genome survey and development of 18 microsatellite markers to assess genetic diversity in Spondias tuberosa Arruda Câmara (Anacardiaceae) and cross-amplification in congeneric species. Molecular Biology Reports 46: 3511-3517.
crossref pdf
Bolger, AM. Lohse, M and Usadel, B. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30: 2114-2120.
crossref pdf
Ellis, JR and Burke, JM. 2007. EST-SSRs as a resource for population genetic analyses. Heredity 99: 125-132.
crossref pdf
Haas, BJ. Papanicolaou, A. Yassour, M. Grabherr, M. Blood, PD. Bowden, J. Couger, MB. Eccles, D. Li, B. Lieber, M. MacManes, MD. Ott, M. Orvis, J. Pochet, N. Strozzi, F. Weeks, N. Westerman, R. William, T. Dewey, CN. Henschel, R. LeDuc, RD. Friedman, N and Regev, A. 2013. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nature Protocols 8: 1494-1512.
crossref pdf
Hara, H. 1957. Synopsis of genus Chrysosplenium L. Journal of the Faculty of Science, University of Tokyo. Section III: Botany 7: 1-90.

Hu, J. Wang, L and Li, J. 2011. Comparison of genomic SSR and EST-SSR markers for estimating genetic diversity in cucumber. Biologia Plantarum 55: 577-580.
crossref
Jung, E-K. Kang, D-H. Yoo, K-O. Kwak, M. Kim, Y-D and Kim, B-Y. 2018. Isolation and characterization of EST-SSR markers for Astilboides tabularis (Saxifragaceae), endangered species in Korea. Korean Journal of Plant Taxonomy 48: 195-200.
crossref pdf
Kim, YI. 2014. Systematic studies of Chrysosplenium L. series Pilosa Maxim. (Saxifragaceae). PhD dissertation,. Hallym University; Chuncheon, Korea. 89-91 (in Korean).

Kim, Y-I and Kim, Y-D. 2015. Chrysosplenium aureobracteatum (Saxifragaceae), a new species from South Korea. Novon 23: 432-436.
crossref
Peakall, R and Smouse, PE. 2012. GenALEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research–an update. Bioinformatics 28: 2537-2539.
crossref pdf
Rozen, S and Skaletsky, H. 1999. Primer 3 on the WWW for general users and for biologist programmers. Methods in Molecular Biology 132: 365-386.

Solórzano, S. Arias, S and Dávila, P. 2016. Genetics and conservation of plant species of extremely narrow geographic range. Diversity 8: 31.
crossref
Thiel, T. Michalek, W. Varshney, RK and Graner, A. 2003. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theoretical Applied Genetics 106: 411-422.
crossref pdf
TOOLS
PDF Links  PDF Links
PubReader  PubReader
ePub Link  ePub Link
Full text via DOI  Full text via DOI
Download Citation  Download Citation
  Print
Share:      
METRICS
1
Web of Science
1
Crossref
0
Scopus
3,563
View
102
Download
Related article
Editorial Office
Korean Journal of Plant Taxonomy
Department of Biology, Daejeon University, Daejeon 34520, Korea
TEL: +82-42-280-2434   E-mail: kjpt1968@gmail.com
About |  Browse Articles |  Current Issue |  For Authors and Reviewers
Copyright © Korean Society of Plant Taxonomists.                 Developed in M2PI