| Home | E-Submission | Sitemap | Editorial Office |  
top_img
Korean J. Pl. Taxon > Volume 55(3); 2025 > Article
PASAMBA, GENTALLAN, TIMOG, QUIÑONES-ARRIBADO, BORROMEO, ENDONELA, and REMOLLO: First record of Senna reticulata (Fabaceae) in the Philippines: Morphological and molecular confirmation of an alien species showing evidence of rapid local establishment in the Zamboanga Peninsula

Abstract

Senna reticulata (Willd.) H. S. Irwin & Barneby (Fabaceae), a species native to South America, is reported here for the first time in the Philippines. A Senna accession from the Zamboanga Peninsula was morphologically distinct from the widely cultivated S. alata (‘akapulko’), exhibiting plano-compressed unwinged pods, pilosulous-puberulent leaflets, and a petiole length exceeding 3.5 cm. Molecular analyses using chloroplast (rbcL) and nuclear (internal transcribed spacer [ITS]) markers supported this identification. The rbcL sequence matched S. reticulata with 100% identity in GenBank, while ITS-based phylogenetic analysis placed the accession in a distinct clade closely related to S. alata, consistent with previous phylogenetic studies. Distribution mapping based on a rapid field survey in 2025, compared with virtual observations from 2016 via Google Maps, confirmed the species’ local establishment along roadsides, riverbanks, and disturbed areas of the Pan-Philippine Highway—from Maria Clara Lorenzo Lobregat Highway in Zamboanga City to AH26 in Tungawan, Roseller T. Lim, and Ipil, Zamboanga Sibugay. This study provides the first confirmed record of S. reticulata in the Philippine flora and presents integrative morphological and molecular pieces of evidence for its identification. Notably, S. reticulata and S. alata are often referred to by the same vernacular name and used interchangeably in traditional medicine due to their similar appearance and growth form in the field.

INTRODUCTION

Senna Miller 1754 (Fabaceae) comprises a diverse group of flowering plants with several of its species known for their medicinal properties and ornamental use (Marazzi and Sanderson, 2010). It has about 250–300 accepted species of tree shrubs and subshrubs dispersed in tropical and subtropical regions, with about 80% distributed in the American region (Irwin and Barneby, 1982; Oladeji et al., 2021; Alshehri et al., 2022). Folk medicine has utilized several of the Senna species as purgatives as they contain anthraquinone derivatives and glucosides, sennosides or senna glycosides (Monkheang et al., 2011; Rahman et al., 2013).
In the Philippines, 11 Senna species have been documented: S. alata (L.) Roxb., S. divaricata (Nees & Blume) Lock, S. fruticosa (Mill.) H. S. Irwin & Barneby, S. hirsuta (L.) H. S. Irwin & Barneby, S. obtusifolia (L.) H. S. Irwin & Barneby, S. occidentalis (L.) Link, S. siamea (Lam.) H. S. Irwin & Barneby, S. spectabilis (DC.) H. S. Irwin & Barneby, S. timoriensis (DC.) H. S. Irwin & Barneby, and S. tora (L.) Roxb. (Pelser et al., 2025). Among these, S. alata, also known as ‘akapulko’, is the only species recognized and endorsed by the Department of Health as one of the ten medicinal plants, valued for its antifungal and dermatological applications (Philippine Pharmacopeia 1, 2004). Its ability to grow in diverse environments and disturbed habitats caused it to be classified also as a weedy species despite widespread cultivation and the potential of its bioactive molecules. The characterization of its taxonomy and other Senna species remains locally understudied with limited morphological and molecular studies available to confirm species identities beyond S. alata.
In the southern Philippines, particularly in the Zamboanga Peninsula, local communities refer to a similar-looking plant as ‘asunting’. This plant exhibits key morphological traits that differ from S. alata such as its pod structure and leaf characters. This local ‘asunting’ have plano-compressed, unwinged pods which are morphological traits of S. reticulata (Willd.) H. S. Irwin & Barneby as described in The American Cassiinae (1982). Native to South America, S. reticulata is a fast-growing species known for its ability to colonize riparian zones and disturbed landscapes. Its rapid growth has been proposed for its potential biomass source for bioenergy production (Grandis et al., 2021). The species has also been recorded to be introduced and cultivated in India (Parolin et al., 2002), but the lack of proper documentation of its identity raises the question on whether the species cultivated is genuinely S. reticulata. Its presence in the Philippines has not been previously documented in floristic accounts which raises questions about its origin, mode of introduction, and ecological impact in Zamboanga (Pelser et al., 2025; POWO, 2025).
Thus, to clarify the taxonomy of this potentially introduced species, we employed an integrative approach to species identification. We also documented its distribution through a rapid inventory conducted along the roadsides and national highway to trace its occurrence and establishment in Zamboanga Peninsula.

MATERIALS AND METHODS

Plant material

The plant material was collected in Philippine Rubber Research Institute (PRRI), Zamboanga Sibugay, and along the roadsides of the Pan-Philippine National Highway, Tigbao, Zamboanga del Sur (7°83′15″N, 123°23′83″E) in January 2025.

Herbarium

Local collections of Senna alata (ICROPS) were revisited and examined to ensure accurate identification. Herbarium specimens housed at the Philippine University Herbarium (PUH) in the University of the Philippines – Diliman, Philippine National Herbarium (PNH), and Singapore Herbarium National Parks Board (SING) were also observed. The voucher specimens (ICROPS 0012025001, ICROPS 0012025002, ICROPS 0012025003) were prepared and deposited at the Philippine Herbarium of Cultivated Plants, Institute of Crop Science, University of the Philippines Los Baños (https://cafs.uplb.edu.ph/icrops/; Curator: Dr. Renerio P. Gentallan Jr., rpgentallan@up.edu.ph).

Morphological characterization

The morphology of the Senna sp. accession was examined using diagnostic morphological markers described for the Senna group in The American Cassiinae monograph (Irwin and Barneby, 1982) to confirm the sample’s identity. It was characterized following the modified Senna alata descriptor list developed by the Crop Breeding and Genetic Resources Laboratory, Institute of Crop Science, College of Agriculture and Food Science, University of the Philippines Los Baños. Ten replicates were used to measure 11 quantitative characteristics. A key to the Philippine Senna species was devised following the descriptions provided in The American Cassiinae by Irwin and Barneby (1982), Flora Malesiana (Hou et al., 1996), and Flora e Funga do Brasil (2025).

DNA extraction and sequencing

The study utilized disease-free leaves of a mature Senna sp. (ICROPS 0012025002). The leaves were pre-dried using silica drying method, and DNA was extracted following the liquid-nitrogen-free CTAB protocol described by Quiñones et al. (2024). Chloroplast and nuclear barcode sequence amplification was done using sequence-specific markers (Table 1) at 94°C for 5 min; 30 cycles of 94°C for 45 s, 55°C for 45 s, and 72°C for 1 min, and 72°C for 7 min, using a thermal cycler (Bio-Rad T100, Hercules, CA, USA).
The PCR products were subsequently sent to Macrogen Inc. (Seoul, Korea) for purification and capillary (Sanger) sequencing. The sequences derived from capillary sequencing subjected to end clipping using Geneious Prime 2024. A nucleotide BLAST (BLASTn) search was conducted using the cleaned sequences to compare them with existing nucleotide sequences in GenBank at National Center for Biotechnology Information (NCBI). The rbcL and internal transcribed spacer (ITS) sequence data that support the findings of this study are openly available in GenBank of NCBI at www.ncbi.nlm.nih.gov under accession no. PX121432 and PV796072, respectively.

Phylogenetic analysis

Forty-six ITS sequences from NCBI were downloaded to serve as ingroup (38 Senna species), sister group (three Cassia species) and outgroup (five related species) under the Umtiza clade of the subfamily Caesalpinioideae in the phylogenetic analysis.
The selection of taxa included in the phylogenetic analysis of the nuclear marker was primarily based on the species utilized by Ringelberg et al. (2022) in their phylogenomic analysis of Caesalpinioideae (Leguminosae) and the new subfamily classification of the Leguminosae based on a taxonomically comprehensive phylogeny by The Legume Phylogeny Working Group (2017). These sequences, along with the partial ITS sequence of ICROPS 0012025002, were aligned using MAFFT (Katoh and Standley, 2013) and, after alignment trimming, phylogenetic analysis was performed using MEGA 12 (Kumar et al., 2024). The model with the lowest Bayesian information criterion score was selected. The phylogenetic tree was generated using the maximum likelihood method following the general time reversible, gamma-invariant (GTR + G + I) model at 1,000 bootstrap replicates.

Distribution mapping

Thirty-one coordinates were recorded as occurrence points of Senna sp. through rapid field inspection in 2025 en route to Zamboanga Sibugay. Closer inspection of the distinct growth habit, leaf, and pod morphology between S. reticulata and S. alata was done to ensure proper identification. To verify and supplement these data with historical records, the initial 31 coordinates were re-examined using Google Maps Street View imagery from 2016 and 2022. Potential populations were visually confirmed by the presence of previously identified stands observable at street level. The GPS coordinates of each verified location were compiled into a CSV file for spatial analysis. The map was generated using QGIS 3.44.0 to visualize its distribution.

RESULTS AND DISCUSSION

Morphological characterization

Three dried specimens (ICROPS 0012025001, ICROPS 0012025002, ICROPS 0012025003) were prepared and examined. Key morphological traits such as the petiole length, leaflet pilosity, and pod shape remained distinctly identifiable after drying and were consistent with the diagnostic features of S. reticulata as described by Irwin and Barneby (1982). The morphology of the examined specimen was depicted in Fig. 1. Morphological characterization of the collected Senna sp. revealed at least seven diagnostic traits aligning with the description of Senna reticulata (Willd.) H. S. Irwin & Barneby and clearly distinguishing it from S. alata (‘akapulko’) (Table 2). The specimen exhibited a petiole length of 12.57 ± 0.88 cm which exceeds the upper range typically observed in S. alata (1–3.5 cm) and falls within the range described for S. reticulata (3.5–13 cm). The seta at the rachis base was dilated into a lance-triangular blade measuring approximately 3.75 ± 0.09 mm, a trait also characteristic of S. reticulata but often subobsolete in S. alata, where the first leaflet pair is inserted near the pulvinus. The leaflets of the specimen were pilosulous-puberulent on both upper and lower surfaces, whereas S. alata typically exhibits glabrous upper leaflet surfaces and sparse hairs limited to the lower veins.
The pod morphology was the definitive delineating character upon first field observation. The examined specimen had plano-compressed and unwinged pods (Fig. 1I) unlike S. alata which bears four-angular, winged pods. Mainly, the pod compression, pilosity, and elongate petiole strongly support the identification of the specimen based on morphologic features as S. reticulata rather than S. alata. The floral morphology needs to be further assessed in future studies to strengthen this identification.
Parolin (2001) referred to Senna reticulata as a pioneer tree native to the Amazonian várzea floodplains and described it as having glabrous leaflets on both surfaces, crenulated-winged pods, and petioles lacking glands. However, these morphological features more closely correspond to Senna alata based on the taxonomic treatment by Irwin and Barneby (1982). The description of Parolin (2001) thus treats S. reticulata and S. alata as the same species. In contrast, the specimen examined in this study exhibits diagnostic traits consistent with the description for S. reticulata as a species distinct from S. alata.

Molecular characterization and phylogenetic analysis

A 608-bp partial rbcL sequence was successfully generated. BLAST analysis against the NCBI nucleotide database revealed a 100% identity and 100% query coverage with a single accession of Senna reticulata (NC_083217.1), despite the presence of over 66 rbcL sequences from various Senna species. This unequivocally supports the identification of the specimen as S. reticulata. When compared with the published S. alata reference sequence (Quiñones et al., 2023), the sequenced region contained six variable nucleotide sites.
In contrast, analysis of a 693-bp partial ITS sequence showed the highest similarity to S. alata (97.03% identity). However, this result is inconclusive, owing to the absence of S. reticulata ITS sequences in GenBank and the sub-threshold identity of the closest taxon. To further assess this, phylogenetic analysis was performed to determine whether the ITS sequence would recover the same topology as that inferred from literature. The ITS alignment spanned 700 bp, with 436 variable sites (62.29%) and 321 parsimony-informative characters (45.86%). In the resulting ITS-based phylogram, the putative S. reticulata accession (ICROPS 0012025002) grouped closely with S. alata with moderate bootstrap support (Fig. 2), consistent with the evolutionary relationship reported by Marazzi et al. (2006) based on three chloroplast markers (rps16, rpl16, and matK). The overall topology of the ITS tree also corresponds well with those recovered in more recent phylogenetic studies (The Legume Phylogeny Working Group, 2017; Ringelberg et al., 2022; Quiñones et al., 2023).
Taken together, the congruence of chloroplast and nuclear molecular evidence reinforces the morphological identification of the specimen as Senna reticulata.

Rapid local establishment

The highest density of occurrences was documented along the Maria Clara Lorenzo Lobregat Highway in Zamboanga City with over 30 closely spaced GPS points from the location coordinates recorded from 2016 and 2022 (Fig. 3). This section of the national highway consists of unmanaged roadside vegetation where populations of Senna species are established. A more scattered distribution was observed along AH26 in Tungawan extending toward the Pagadian City–Zamboanga City Road in Roseller T. Lim and Ipil, Zamboanga Sibugay. This indicates a wider distribution of the species within the region. Field observations in 2025, together with historical Google Maps imagery (2016–2022), revealed population increase of the species over the six-year observable period, suggesting rapid local establishment up to the present. While formal monitoring has not yet been conducted, the sustained and widespread presence in disturbed habitats suggests the species may have the potential to naturalize in the area.
Senna reticulata was observed forming dense stands along roadsides, agricultural fields, and riverbanks, primarily in disturbed secondary vegetation within the study area. Based on current floristic records (POWO, 2025), this species is not native to the Philippines and is considered a newly introduced species. Field observations documented its establishment in fallow agricultural land and its capacity to form dense thickets. Local reports also noted difficulty in eradicating established individuals (PRRI staff, pers. comm.). Ecologically, S. reticulata exhibits traits commonly associated with invasive species, including rapid growth (reaching up to ~4 m within months), the ability to form dense, monospecific stands, tolerance to seasonal flooding, and vigorous vegetative regrowth following disturbance—traits well-documented in Amazonian várzea ecosystems (Parolin, 2001).
Its presence in the Philippines has not been previously documented in floristic accounts (Blanco, 1845; Merrill, 1923; Hou et al., 1996; Pelser et al., 2023; iNaturalist, 2025a, 2025b). Additionally, there were no records of the species in local and international herbaria (PNH, PUH, SING), suggesting its recent introduction. Based on its characteristics and its observed presence in the region, several potential introduction pathways can be hypothesized. One possibility is its intentional introduction as an ornamental plant or for use in traditional medicine, as it bears a strong resemblance to the widely cultivated Senna alata (‘akapulko’/’asunting’). Another possibility is an unintentional introduction, where the seeds or other plant material were introduced as a contaminant in agricultural products or through human-mediated transport. This hypothesis is supported by the species’ rapid growth and ability to colonize disturbed landscapes, such as roadsides, riverbanks, and fallow agricultural lands, where it forms dense stands. While the specific route of introduction remains unknown, the species may pose a threat to native plant communities and warrants formal evaluation under national invasive species monitoring frameworks given its alien status, progressive colonization, and ecological traits.

Taxonomic Treatment

Senna reticulata (Willd.) H. S. Irwin & Barneby, Mem. New York Bot. Gard. 35: 458, 1982.
Description: Habit shrub to small tree. Stems with fine, short, or soft hairs. Stipules lanceolate to triangular. Leaves with petiole (9–)10–13(−16) cm long; rachis >21 cm long; extrafloral nectary absent. Leaflets 6–10 pairs, oblong, (9−)10–11 × 3–4 cm, apex round. Inflorescence yellow raceme; bracts ovate. Flowers zygomorphic; central upper petal obovate; fertile stamens 6. Pods flat, black, pendulous, long-linear, 11–12 × (1.3−)1.4–1.5 cm. Seeds 1-seriate, brown, 7–8 × 2–4 × 1–2 mm.
Origin: South Mexico, Trinidad, South America (POWO, 2025).
Introduced: Zamboanga city, Zamboanga del Sur, and Zamboanga Sibugay, Philippines (this study).
Habitat and ecology: This shrub thrives in disturbed areas, roadsides, riverbanks, and near paddy fields.
Specimens examined (Fig. 4): Philippines. Zamboanga Sibugay, 2025, Pasamba, Gentallan, Timog, Hernandez 0012025001 (ICROPS); Zamboanga Sibugay, 2025, Pasamba, Gentallan, Timog, Hernandez 0012025002 (ICROPS); Zamboanga Sibugay, 2025, Remollo 0012025003 (ICROPS).
Other specimens examined (Senna alata):
Philippines. Luzon–Batanes: Batan Island, 1961, Quisumbing, del Rosario & Guiterrez 79259 (PNH). Bataan: Pilar, 1954, Banzon 3542 (PUH); Lamao River, Mt. Mariveles, 1905, Meyer 2583 (SING); Lamao River, Mt. Mariveles, 1904, Meyer 2198 (SING). Bulacan: Balintawak Km. 8, 1946, Mendoza 3076 (PNH). Ilocos Norte: Sto. Niño, 1983, Vendivil & Reynoso 160625 (PNH); Sto. Niño, 1983, Vendivil & Reynoso 160636 (PNH). Laguna: Mt. Makiling, 1945, Sulit 8332 (PNH); Bo Kapatalan Siniloan, 230 m, 1971, Francia 5779 (PUH). Manila: Manila, 1906, McGregor 1743 (SING). Palawan: Taripan, 40m, 1962, Fox 154625 (PNH). Mindoro: Calagbay, 1939, Ebalo 57455 (PNH); Bongabon & Pinamalayan, 1941, Maliwanag 57218 (PNH); NE of Mt. Yagaw, Oriental Mindoro, 1957, Conklin 37579 (SING). Palawan: Baraki, 500 m, 1950, Fox 13365 (PNH); Lipso, 15 m, 1984, Holol 150965 (PNH). Quezon: Kinagunan Ibaba, Agdangan, 1976, Francisco 170824 (PNH); Mt. Binayabas, Atimonan, 1977, Vendivil & Reynoso 169437 (PNH). Rizal: 1946, Quisumbing 2107 (PNH). Zambales: Sta. Rita, Masinloc, 1977, dela Cruz & Fernando 123522 (PNH). Visayas–Iloilo: San Joaquin, 1953, Taleon 22393 (PNH). Mindanao–Agusan: Mt. Hilonghilong, 830 m, 1949, Mendoza & Convocan 10687 (PNH). Cagayan: Solana, 1980, Rocero 152842 (PNH). Mindanao–Davao: Digos, 1950, Añonuevo 13690 (PNH). Sulu: Taganak Island, 1957, Kondo & Edaño 38888 (PNH). Zamboanga del Sur: Lapuyan, 1984, Filomena 159953 (PNH). Zamboanga Sibugay: Mt. Kumayo, 1940, Ebalo 57687 (PNH).
Vernacular names: akapulko (Tag./Bis.), asunting (Bis.).
Taxonomic note: Based on our morphological and molecular data, we confirm the first known record of the Senna reticulata in the Philippines. The unrecorded species discussed here is locally referred to as ‘akapulko’ or ‘asunting’. It is known for its antifungal properties. Its late detection in the area may be attributed to its confusion with S. alata as these two species are often referred to by the same vernacular name and used interchangeably in traditional medicine due to their resemblance in appearance, growth form, and medicinal properties. Examination of Senna herbarium collections in the Philippines revealed no verifiable specimens of S. reticulata, suggesting that it may be a recent introduction.
Population of the species was observed along the roadside from Zamboanga del Sur to Zamboanga Sibugay. The species thrives in disturbed and open conditions. Irwin and Barneby (1982) described the species as seldom forming extensive thickets; however, the population observed was densely established along the national highway.

Key to the Senna species in the Philippines

  • 1. Glands absent from both petioles and rachis.

    • 2. Pedicels shorter than sepals.

      • 3. Rachis ending in slender seta; leaflets usually glabrous above, petiole ≤ 3.5 cm long; pods sharply four-angular, winged ········································································································································ S. alata

      • 3. Rachis ending in dilated deltate or lance-triangular blade; leaflets pilose, petiole > 3.5 cm long; pods plano-compressed, not winged ····················································································································· S. reticulata

    • 2. Pedicels longer than sepals.

      • 4. Pods terete ··················································································································· S. spectabilis

      • 4. Pods flat.

        • 5. Petiole 2.5–3.5 cm long; pods flat, alternating bulging and depressed ··········································· S. siamea

        • 5. Petiole 1.5–2.5 cm long; pods flat, annulate-septate ····························································· S. timoriensis

  • 1. Glands present on either petioles or rachis.

    • 6. Glands only on petioles.

      • 7. Plant fetid, roughly hairy; pods strigose, angular ········································································· S. hirsuta

      • 7. Plant inodorous, glabrous or nearly so; pods glabrous, terete or flat.

        • 8. Petiolar gland globose or ovoid, at the basal joint; pods flat ················································· S. occidentalis

        • 8. Petiolar gland clavate or subulate, above the basal joint; pods terete ··········································· S. sophera

    • 6. Glands only on rachis between leaflet pairs.

      • 9. Leaflets 2 pairs ··············································································································· S. fruticosa

      • 9. Leaflets 3 or more pairs.

        • 10. Leaflets 6–11 pairs ····································································································· S. divaricata

        • 10. Leaflets 3 pairs.

          • 11. Subulate gland present only between the lowermost leaflet pair; pod 2–4.5 cm ····················· S. obtusifolia

          • 11. Subulate gland present between the two lowermost leaflet pairs; pod up to 1.5 cm ······················· S. tora

NOTES

ACKNOWLEDGMENTS
This study was supported by the Department of Science and Technology-Philippine Council for Agriculture, Aquatic and Natural Resources Research and Development (DOST-PCAARRD) and Department of Science and Technology-Philippine Council for Health Research and Development (DOST-PCHRD). The authors extend their gratitude to the local government units of Zamboanga Peninsula and Philippine Rubber Research Institute (PRRI), Zamboanga Sibugay, and Ms. Deborah B. Delos Reyes for their assistance and support. We thank the Philippine National Herbarium (PNH), Philippine University Herbarium (PUH), and Singapore Herbarium National Parks Board (SING) for the access to Senna herbarium specimens, and Mr. Jose M. Remollo III for the plant samples collected in Zamboanga Sibugay.
CONFLICTS OF INTEREST
The authors declare that there are no conflicts of interest.

Fig. 1
Morphological characteristics of Senna reticulata (ICROPS 0012025001). A Growth habit of shrub with inflorescences. B rachis with red arrow indicating the points of first leaflet attachment. C adaxial side of a leaflet. D leaflet apex with venation detail. E bract. F inner view of the bract and bracteole. G inner view of the flower exposing stamens. H petal wing. I mature pod. J seed.
kjpt-55-3-147f1.jpg
Fig. 2
Phylogram reconstructed using ML method based on the ITS sequences of Senna spp. with their respective accession numbers in parentheses.
kjpt-55-3-147f2.jpg
Fig. 3
Distribution of Senna species in Zamboanga Peninsula.
kjpt-55-3-147f3.jpg
Fig. 4
Herbarium specimens of Senna reticulata (ICROPS 0012025001, 0012025002).
kjpt-55-3-147f4.jpg
Table 1
Chloroplast and nuclear barcode marker utilized for Senna sp. amplification (White et al., 1990; CBOL Plant Working Group, 2009).
Region Primer Sequence (5′-3′)
cpDNA rbcL rbcLaF ATGTCACCACAAACAGAGACTAAAGC
rbcLaR TGAAAATCAAGTCCACCRCG
nrDNA ITS ITS4 TCCTCCGCTTATTGATATGC
ITS5 GGAAGTAAAAGTCGTAACAAGG
Table 2
Comparison of the observed major characteristics of Senna alata and Senna reticulata.
Character S. alata S. reticulata
Growth habit Shrubs up to 4–6(−10) m Taller shrubs ≥ 6 m
Branch surface Minutely pilosulous near pulvinus Pilosulous-puberulent throughout
First pair of leaflets insertion ≤3.5 cm distant, often subcontiguous to the pulvinus >3.5 cm distant from the pulvinus
Leaflet surface Major veins minutely puberulent Pilose; deep green drying, paler beneath
Stipules Deltate-triangular Obliquely triangular-lanceolate
Pod Winged, four-angular Linear straight, plano-compressed
Seed shape Rhomboid Oblong-claviform

LITERATURE CITED

Alshehri, M. M., Quispe, C. Herrera-Bravo, J. Sharifi-Rad, J. Tutuncu, S. Aydar, E. F. Topkaya, C. Mertdinc, Z. Ozcelik, B. Aital, M. Kumar, A. N. V. Lapava, N. Rajkovic, J. Ertani, A. Nicola, S. Semwal, P. Painuli, S. González-Contreras, C. Martorell, M. Butnariu, M. Bagiu, I. C. Bagiu, R. V. Barbhai, M. D. Kumar, M. Daştan, S. D. Calina, D. and Cho, W. C. 2022. A review of recent studies on the antioxidant and anti-infectious properties of Senna plants. Oxidative Medicine and Cellular Longevity 2022: 6025900.
crossref pmid pmc pdf
Blanco, M. 1845. Flora de Filipinas: Segun el Sistema Sexual de Linneo. Candido Lopez, Manila. Pp. 887 pp.

CBOL Plant Working Group 2009. A DNA barcode for land plants. Proceedings of the National Academy of Sciences of the United States of America 106: 12794-12797.
pmid pmc
Flora e Funga do Brasil 2025. Jardim Botânico do Rio de Janeiro. Retrieved Jun. 16, 2025, available from http://floradobrasil.jbrj.gov.br/.

Grandis, A., Arenque-Musa, B. C. Martins, M. C. M. Maciel, T. O. Simister, R. Gómez, L. D. and Buckeridge, M. S. 2021. Senna reticulata: A viable option for bioenergy production in the Amazonian region. BioEnergy Research 14: 91-105.
crossref pdf
Hou, D., Larsen, K. and Larsen, S. S. 1996. Caesalpiniaceae (Leguminosae-Caesalpinioideae). Flora Malesiana Series I 12: 409-730.

iNaturalist 2025a. Senna alata. Retrieved Jun. 16, 2025, available from https://www.inaturalist.org/taxa/81515-Senna-alata.

iNaturalist 2025b. Senna reticulata. Retrieved Jun. 16, 2025, available from https://www.inaturalist.org/taxa/290362-Senna-reticulata.

Irwin, H. S. and Barneby, R. C. 1982. The American Cassiinae: A Synoptical Revision of Leguminosae Tribe Cassieae Subtribe Cassiinae in the New World. New York Botanical Garden, Bronx, NY. Pp. 918 pp.

Katoh, K. and Standley, D. M. 2013. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30: 772-780.
crossref pmid pmc
Kumar, S., Stecher, G. Suleski, M. Sanderford, M. Sharma, S. and Tamura, K. 2024. MEGA12: Molecular Evolutionary Genetic Analysis version 12 for adaptive and green computing. Molecular Biology and Evolution 41: msae263.
crossref pmid pmc
Marazzi, B., Endress, P. K. De Queiroz, L. P. and Conti, E. 2006. Phylogenetic relationships within Senna (Leguminosae, Cassiinae) based on three chloroplast DNA regions: Patterns in the evolution of floral symmetry and extrafloral nectaries. American Journal of Botany 93: 288-303.
crossref pmid
Marazzi, B. and Sanderson, M. J. 2010. Large-scale patterns of diversification in the widespread legume genus Senna and the evolutionary role of extrafloral nectaries. Evolution 64: 3570-3592.
crossref pmid
Merrill, E. D. 1923. An Enumeration of Philippine Flowering Plants. Bureau of Printing, Manila.

Monkheang, P., Sudmoon, R. Tanee, T. Noikotr, K. Bletter, N. and Chaveerach, A. 2011. Species diversity, usages, molecular markers and barcode of medicinal Senna species (Fabaceae, Caesalpinioideae) in Thailand. Journal of Medicinal Plants Research 5: 6173-6181.

Oladeji, O. S., Adelowo, F. E. and Oluyori, A. P. 2021. The genus Senna (Fabaceae): A review on its traditional uses, botany, phytochemistry, pharmacology and toxicology. South African Journal of Botany 138: 1-32.
crossref
Parolin, P. 2001. Senna reticulata, a pioneer tree from Amazonian várzea floodplains. The Botanical Review 67: 239-254.
crossref pdf
Parolin, P., Oliveira, A. C. Piedade, M. T. F. Wittmann, F. and Junk, W. J. 2002. Pioneer trees in Amazonian floodplains: Three key species form monospecific stands in different habitats. Folia Geobotanica 37: 225-238.
crossref pdf
Parolin, P. 2005. Senna reticulata (Willd.) H. S. Irwin & Barneby (Fabaceae) as “pasture killer” (“matapasto”) pioneer tree in Amazonian floodplains. Ecologia Aplicada 4: 41-46.
crossref
Pelser, P. B., Barcelona, J. F. and Nickrent, D. L. 2023. Co’s Digital Flora of the Philippines. Retrieved Jun. 16, 2025, available from http://www.philippineplants.org.

Pelser, P. B., Barcelona, J. F. and Nickrent, D. L. 2025. Co’s Digital Flora of the Philippines. Retrieved Jun. 16, 2025, available from http://www.philippineplants.org.

Philippine Pharmacopeia 1 (PPI) 2004. Philippine Pharmacopeia, 1. Bureau of Food and Drugs, Department of Health and Japan International Cooperation Agency. Himiko Arts and Concepts, Manila.

POWO 2025. Plants of the World Online. Retrieved Jan. 28, 2025, available from https://powo.science.kew.org/.

Quiñones, K. J. O., Gentallan, R. P. Jr Bartolome, M. C. B. Madayag, R. E. Vera Cruz, J. R. A. Cirunay, A. R. T. Endonela, L. E. Timog, E. B. S. Borromeo, T. H. Altoveros, N. C. Alvaran, B. B. S. Magtoltol, J. B. and Cejalvo, R. D. 2023. The complete chloroplast genome of Senna alata (L.) Roxb., an important medicinal plant from the Philippines. Mitochondrial DNA Part B Resources 8: 244-248.
crossref pmid pmc
Quiñones, K. J. O., Gentallan, R. P. Jr Timog, E. B. S. Vera Cruz, J. R. A. Macabecha, C. G. A. Papa, I. A. Coronado, N. B. Bartolome, M. C. B. Ceribo, D. B. Madayag, R. E. Magtoltol, J. B. Sienes, R. K. A. Alvaran, B. B. S. and Borromeo, T. H. 2024. Liquid-nitrogen-free CTAB DNA extraction method from silica-dried specimens for next-generation sequencing and assembly. MethodsX 12: 102758.
crossref pmid pmc
Rahman, M. O., Rahman, M. Z. and Begum, A. 2013. Numerical taxonomy of the genus Senna Mill. from Bangladesh. Bangladesh Journal of Plant Taxonomy 20: 77-83.

Ringelberg, J. J., Koenen, E. J. M. Iganci, J. R. de Queiroz, L. P. Murphy, D. J. Gaudeul, M. Bruneau, A. Luckow, M. Lewis, G. P. and Hughes, C. E. 2022. ? Phylogenomic analysis of 997 nuclear genes reveals the need for extensive generic redelimitation in Caesalpinioideae (Leguminosae). PhytoKeys 205: 3-58.
crossref pmid pmc pdf
The Legume Phylogeny Working Group (LPWG) 2017. A new subfamily classification of the leguminosae based on a taxonomically comprehensive phylogeny: The Legume Phylogeny Working Group (LPWG). Taxon 66: 44-77.

White, T. J., Bruns, T. Lee, S. and Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications. Innis, M. A., Gelfand, D. H. Sninsky, J. J. and White, T. J. (eds.), Academic Press, New York. Pp. 315-322.
crossref
TOOLS
PDF Links  PDF Links
PubReader  PubReader
ePub Link  ePub Link
Full text via DOI  Full text via DOI
Download Citation  Download Citation
  Print
Share:      
METRICS
0
Crossref
0
Scopus
2,486
View
120
Download
Related article
Editorial Office
Korean Journal of Plant Taxonomy
Department of Biology, Daejeon University, Daejeon 34520, Korea
TEL: +82-42-280-2434   E-mail: kjpt1968@gmail.com
About |  Browse Articles |  Current Issue |  For Authors and Reviewers
Copyright © Korean Society of Plant Taxonomists.                 Developed in M2PI